Identification of yeast species from uncultivated soils by sequence analysis of the hypervariable D1/D2 domain of LSU–rDNA gene in Kermanshah province, Iran

Document Type : Original Article

Authors
Department of Plant Protection, College of Agriculture, Razi University, Kermanshah, Iran
10.22043/mi.2017.26130
Abstract
Yeasts are a polyphyletic group of ascomycete and basidiomycete fungi characterized by having a unicellular growth phase and sexual stages that are not enclosed in fruiting bodies. An attempt was made to identify yeast species in uncultivated soils collected from different areas of Kermanshah province, Iran, by analyzing hypervariable D1/D2 domain of the large subunit (LSU) rDNA gene sequenceand comparing the sequences with that available in NCBI database. In this study, 25 soil samples were analyzed and eight species including Rhodotorula toruloides (KP324973)*, Trichosporon coremiiforme (KP055040)*, Naganishia uzbekistanensis (KP324959), Candida catenulata (KP324968), C. paracilopsis (KP324965)*, C. boidinii (KP324 962)*, Lecythophora sp. (KP336745)* and Meyerozyma guilliermondii (KPKP324971, KP324978)were identified. Phylogenetic analysis based on D1/D2 regions allowed us to establish the precise taxonomic placement of each species. The Canonical correspondence analysis (CCA) indicated that elevation, EC, pH, and clay were important environmental parameters influencing basidiomycete yeast distribution in uncultivated soils. In this study, the presence of eight species is confirmed that asterisk species are the new records for the mycobiota of Iran.
Keywords
Subjects

INTRODUCTION

Yeasts are a polyphyletic group of ascomycete and basidiomycetous fungi characterized by having a unicellular growth phase and sexual stages that are not enclosed in fruiting bodies (Kurtzman & Fell 1998). Most yeasts are saprotrophs that assimilate plant or animal–derived organic compounds. Yeasts are usually decomposers, however, some species are pathogens of plants and animals. They facilitate production of fermented foods and alcoholic beverages, production of secondary metabolites, vitamins, organic acids, carotenoid and recombinant vaccine (Hierro et al. 2004). A large number of yeasts catabolize benzene compounds which may ease cleaning up spills of industrial chemicals and human friendly biosynthesized new compounds (Middelhoven 1993). Kurtzman and Fell (1999) reported approximately 100 genera of yeasts comprising more than 700 species have been identified which is less than 1% of the world species. Many yeasts are isolated from soils and have cosmopolitan distribution which spray them in both natural and artificial substrates (Phaff et al. 1966, Spencer & Spencer 1997).

Some species, including Debaryomyces (Schwanniomyces) occidentalis, Lipomyces spp., Schizoblastosporion starkeyihenricii, Cryptococcus and certain Rhodotorula and Sporobolomyces species, are isolated exclusively from soils (Hagler & Ahearn 1987). The occurrence of yeasts in the soil has been studied in various parts of the world (Jensen 1963, Vishniac 1996, Dmitriev et al.1997). Slavikova and Vadkertiova (2000) showed that Cryptococcus laurentii, Cystofilobasidium capitatum, Leucosporidium scottii, Rhodotorula aurantiaca, and Trichosporon cutaneum were the most frequently isolated species from the samplestaken in soil forest of Slovakia.

Intensive researches on diversity of yeasts in extreme environments have been conducted (Gadanho et al. 2006, Nagahama et al. 2001, Tosi et al. 2002). Mok et al. (1984) and Baublis et al. (1991) isolated yeasts from tropical and Antarctic soils respectively. Connell et al. (2006) studied the distribution and abundance of yeasts in Antarctica soil from Taylor Valley. The diversity of microorganisms is the building block of the ecological balance of the biosphere (Slavikova & Vadkertiova 2000). Monitoring fungal diversity has been fundamental to the increased interest of microbiological functions. Yeasts are important members in many ecosystems and form a significant contribution to the biodiversity (Fleet, 1998).

The soil is the ultimate repository to store and develop of certain species of yeasts (Phaff and Starmer 1987). An accurate identification of species in the ecosystem and proper molecular tools are necessary factors to determine the validity of studies in yeast ecology (Kurtzman & Fell 2006).

The correct identification of yeasts is not always easy and morphology does not suffice to distinguish those fungal species which have very few discernible morphological traits. Identification of yeasts species is traditionally carried out by help of morphological and physiological traits (Kurtzman & Fell 1998) or by biochemical techniques (Barnett et al. 2000). These criteria are poorly sufficient for species with very similar morphological features and difficult to identify at the species level (Deak & Beuchat 1996). Conventional yeast identification based on phenotypic characteristics is often misleading and inconclusive, and usually needs to be corroborated by molecular methods. DNA–DNA hybridization (Vaughan Martini & Martini 1987, Torok et al. 1993), electrophoretic karyotyping (Vezinhet et al. 1990, Guillamon et al. 1996) and RFLPs of chromosomal DNA (Versavaud & Hallet 1995) tools have been developed to identify and characterize yeast species however have become less popular compared to other faster and easier molecular techniques. Within these molecular techniques, PCR based methods have permit both intra–species differentiation and species identification of yeast isolates (de Barros Lopes et al. 1998).

Mokhtarnejad et al (2015a) introduced 25 species of basidiomycete yeasts from soil of Iran. They also recorded six new species of ascomycete yeasts such as (Meyerozyma guilliermondii, Metschnikowia sinensis, Debaryomyces hansenii, D. subglobosus, Torulaspora delbrueckii and Candida baotianensis) that isolated in hypersaline soils of Urmia Lake basin (North West of Iran) (Mokhtarnejad et al. 2015b).In other study, Mokhtarnejad et al. (2016) showed that Solicoccozyma aeria is the dominant yeast species in hypersaline soils of Urmia Lake National Park (Mokhtarnejad et al. 2016).Also, twenty–one species belonging to the genera Cystobasidium, Holtermanniella, Naganishia, Rhodotorula, Saitozyma, Solicoccozyma, Tausonia, Vanrija, and Vishniacozyma isolated and identified from this area.

This study was aimed to identify yeast strains present in uncultivated soils using molecular methods and evaluation of environmental parameters on their distribution.

 

MATERIALS AND METHODS

Sample collection and soil analysis

Twenty five soil samples (five soil sub–samples from each area were collected and mixed) were collected from 5–10 cm depth, sieved 2 mm, 40 and 60 mesh sieves in Kermanshah province (Fig 2). Soil texture was analyzed using Gee and Bauder (1986) method. pH of each sample was measured after preparation of soil suspension (one gram of soil to five mL deionized water) using pH meter (Thomas 1996) and total soluble salts measured using electrical conductivity meter (Rhoades 1996).

 

Isolation of yeasts

According to the procedure is described in Waksman & Fred, 1922) ten g of soil samples were placed in 90 mL of 0.1% water-–agar containing 100 ppm NPX (Nonylphenyl polyethylene glycol ether containing a concentration of 10.5 moles of ethylene oxide), mixed and serially diluted to 10–2 to 10–5 and 1 mL of each solution flooded on yeast extract malt extract agar (YM agar). Yeast malt agar prepared by adding 3 g yeast extract, 3 g malt extract, 5 g peptone, and 10 g glucose to one liter of distilled water. These media were amended with HCl (0.7 ml.L–1) and chloramphenicol (0.1g.L–1). Plates were incubated at 25–27 ºC for 3–5 days for a fine colony development. Morphological properties were determined for each isolate using Yamamoto et al. (1991) methods. The production of pigments and shape of colonies of yeast was examined.

 

 

Molecular identification

DNA extraction

The isolates were grown for approximately 24 h at 25 °C in YM medium. For each isolate, one loop of cells suspended in 100 µL distilled water and heated for 5 min at 99 °C (Suhet al., 2008). The DNA extraction was performed using the methods described by Suhet al. (1998). The amount of DNA obtained was estimated by a NanoDrop spectrophotometer (CARY100 scan Varion, Australia).

 

DNA amplification and sequencing

The D1/D2 domain at the 5' end of the LSU rRNA gene was symmetrically amplified with primers NL–1 (5'–GCATATCAATAAGCGGAGGAAAAG–3') and NL–4 (5'–GGTCCGTGTTTCAAGACGG–3') (O'Donell, 1993, Kurtzman & Robnet, 1998). Amplifications were performed in a T–Personal thermocycler (Biometra, Germany). The PCR mixture contained: 10–20 ng of template DNA, 1 μM of each primer, 100 μM of dNTPs, 0.4 U Taq DNA polymerase (CinnaGen, Iran), 1.5 mM of MgCl2, 2.5 μL of 10X PCR buffer in a reaction volume of 25 μL. All PCRs consisted of 1 cycle of 95 °C for 5 min; 35 cycles of 95 °C for 1 min, 55.5 °C for 2 min, 72 °C for 2 min; and a final cycle of 72 °C for 10 min. Successful amplification was confirmed by gel electrophoresis (1 h at 80 Volts) on 1.0% agarose gels in 1X TBE buffer. Gels were stained using ethidium bromide and DNA fragments were visualized under UV light.

Sequencing of PCR product

The amplification products of all specimens were purified through GenJET PCR purification kit (Fermentas, UK) to remove excess primers and nucleotides. PCR products were sequenced (Tech Dragon, Hong Kong) in forward and reverse orientation using the primers used for amplification and a dye terminator cycle sequencing kit (BigDye sequencing kit, Applied Biosystems, USA) on an ABI377–96 automated sequencer (Applied Biosystems, USA) according to the manufacturer's instruction. All sequences of the D1/D2 domain of the LSU–rDNA gene deposited at the GenBank (NCBI, http://www.ncbi.nlm.nih.gov/Entrez) (Bethesda, MD, USA).

Phylogenetic analysis

Closest matches to each sequence were determined using the BLASTN sequence similarity search tool in GenBank (Altschul et al. 1997, Thompson et al. 1997). Multiple alignments were performed with CLUSTAL W (Thompson et al. 1996) using default settings and were manually optimized with BIOEDIT v.7.0.9 (Hall 1999). Phylogenetic analyses were performed with Mega 4 (Kumar et al. 2004) using maximum parsimony (MP) and neighbor–joining (NJ) with the Kimura 2–parameter (K2P) model. The complete deletion method was employed in gap handling for all alignment sites. All sites containing alignment gaps were removed from the analysis before calculations and then treated as missing data. The confidence of branching was assessed by computing 500 bootstrap re–samplings (Felsenstein 1985). The final tree and matrix of sequences were submitted to TreeBASE (University at Buffalo, USA; http://www. treebase.org).

 Statistical analysis

Canonical correspondence analysis (CCA) was used to examine the significance of soil texture, soil pH, total soluble salt and elevation on the distribution and abundance of yeast genotypes in different areas of Kermanshah province using CANOCO software 4.5 (Microcomputer Power, Ithaca, NY, USA). Soil parameters were tested for significant differences between the sites using Turkey’s Post Hoc Test.

RESULTS

Soil analysis

The results of physico–chemical analyses on soil samples of different areas of Kermanshah province are shown in Table 1. Statistical analysis using Tukey’s Post Hoc Test showed differences in soil structure parameters and amount of EC and pH among sites. The collected soils were mostly in sandy, loamy sand and alkaline pH. These soils were considered as basic and non–saline soils.

Environmental parameters

The relative importance of the determined environmental parameters to the distribution of yeasts in different areas of Kermanshah province is illustrated in CCA biplot (Fig. 1) where environmental parameters and yeasts are arranged on the basis of their scores on two axes. The relative position of the arrows reflects the relationship of the axes with the environmental parameters. Eigenvalues for axes 1 and 2 were 0.2and 0.69, respectively.

Table 1. Sources, GPS information and physico–chemical parameters of soil samples from different areas of Kermanshah province, Iran

 

Location

Latitude

Longitude

Elevation (m)

Specimen code

pH

EC (dSm–1)

Sand (%)

Clay (%)

Silt (%)

Yeasts

Kangavar (21)

380 4´.12 N

380 10´.47 E

1481

21

7.30c

0.495b

55.44e

4.56a

40c

B

Sarab Bidsorkh

380 4´.12 N

380 9´.0 E

1493

22

7.45c

0.381b

43.44c

27.34c

29.22b

Sahneh (23)

380 4´.27 N

380 11´.16 E

1334

23

7.52d

0.338a

62.80e

15.20b

22b

B

Bisetum (24)

380 4´.20 N

380 4´.47 E

1303

24

7.15b

0.923c

66f

2a

32b

B

Shahrokh village (25)

380 3´.36 N

380 9´.36 E

1328

25

7.20b

0.551b

55.44e

7.44a

37.12c

A

Kani sharif village

380 3´.36 N

380 15´.0 E

1327

26

7.31c

0.486b

59.50e

0.56a

39.94c

Ravansar

380 3´.36 N

380 23´.24 E

1391

27

7.27b

0.207a

55.50e

27.4c

1.10a

Biashush

380 3´.36 N

380 31´.12 E

1650

28

7.26b

0.298a

51.88d

31c

17.12b

Javanrood (20)

380 3´.36 N

380 30´.0 E

1272

29

7.61d

0.449b

59.44e

11.44b

29.12b

B

Chambegar (11)

380 3´.36 N

380 29´.24 E

1292

30

7.38c

0.249a

22.80a

49.20d

28b

B

Nazarcheshmeh (10)

380 3´.36 N

380 28´.48 E

1458

31

7.43c

0.271a

15.20a

48.8d

36c

B

Davaleh (9)

380 3´.39 N

380 28´.15 E

1243

32

7.04a

0.476b

54d

27.40c

18.60b

A

Salas

380 3´.36 N

380 25´.37 E

1278

34

7.50d

0.282a

52d

25c

23b

Chamzereshk

380 3´.39 N

380 23´.2 E

1427

35

7.37c

0.247a

42c

29.84c

28.16b

Palan (15)

380 3´.36 N

380 19´.1 E

1791

36

6.95a

0.415b

50d

2a

48d

A

Kapar babaei (4)

380 3´.38 N

380 19´.41 E

857

37

7.07a

0.656b

47.44d

13.44b

12.12a

B

Sarpol Zahab (17)

380 3´.25 N

380 18´.40 E

574

38

7.29b

0.434b

51.44d

30c

18.56b

A

Sarpol Zahab (13)

380 3´.25 N

380 11´.31 E

543

39

7.19b

0.422b

62e

18.72b

19.28b

A

Habibvand

380 3´.28 N

380 6´.21 E

778

40

7.29b

0.494b

58e

2a

40c

Karande Gharb (22)

380 3´.36 N

380 58´.33 E

1501

41

7.81d

1.104c

77.44f

3.44a

25.12b

B

Karande Gharb (16)

380 3´.39 N

370 55´.19 E

1535

42

7.28b

0.361b

34b

6a

60d

B

Eslam Abad (1)

380 3´.46 N

370 45´.46 E

1372

43

7.80d

0.349a

59.44e

18b

22.56b

B

Eslam Abad (5)

380 3´.50 N

370 46´.5 E

1401

44

7.32c

0.249a

58.66e

5.44a

36c

A

Mahin Dasht (3)

380 4´.1 N

370 57´.57

1473

46

7.54d

0.472b

26.50b

18.5b

55d

A

 

The yeast species and environmental variables are significantly correlated for axis one. Although pH, silt, clay, elevation and EC are negatively correlated with the first CCA axis, sand showed a positive correlation (Fig. 1). Basidiomycete yeasts on the left side of the diagram showed more prevalent in soil with high clay and silt percentage compared to ascomycete yeasts (Fig.1). Distribution of ascomycete yeasts was independent of environmental parameters (Fig.1).

 

Fig 1. Correspondence analysis (CA) of the ascomycete and basidiomycete yeast communities found in uncultivated soils. The Eigenvalues of the first and second axes in the two–dimensional ordination diagrams are as: CA1 = 0.20and CA2 = 0.69. Dash line refer to ascomycete yeasts and continuous line refer to basidiomycetous yeasts.

 

Isolation of yeast colonies from soil samples

In this study, 25 soil samples of different areas of Kermanshah province were collected and studied for the prevalence of yeast species that 28 yeast isolates were obtained (Fig. 2). These isolates were identified by morphological characteristics (Fig. 3). The isolates were comprised of six genera (Rhodosporidium, Trichosporon, Cryptococcus, Candida, Lecythophora, Meyerozyma) and eight species of yeasts. Out of 28 isolated and identified species, 18 species are belonged to Basidiomycota while 10 species are belonged to ascomycete yeasts. Basidomycete species constituted 74% of the eight isolated species. Naganishia uzbekistanensis (35.71%) and Candida species (25%) were the most prevalent species followed by Trichosporon coremiiforme (17.85%)andRhodotorula toruloides (10.71%). The remaining species were less frequently isolated. Some species including; Rhodotorula. toruloides, T. coremiiforme, C. catenulata, C. boidinii and Lecythophora* sp. are new species for mycobiota of Iran. Voucher specimens deposited in the Culture Collection of the Ministry of Jihad–e–Agriculture (IRAN) Located at the Iranian Research Institute of Plant Protection, Tehran, Nos: IRAN 2634C (Rhodotorula toruloides), IRAN 2635C (Trichosporon coremiiforme), IRAN 2636C (Naganishia uzbekistanensis), IRAN 2637C (C. catenulata), IRAN 2638C (C. boidinii), IRAN 2639C (Lecythophora sp.) and IRAN 2640C (Meyerozyma guilliermondii).

 

Fig. 2. Distribution of identified yeasts species in uncultivated soil in Kermanshah province (GIS Map). Blue: basidiomycete yeasts and Red: ascomycete yeasts.

 

Morphological and Molecular characters

According to the morphological characters, as well as the color of colonies on the 16% NaCl–agar medium, the yeast isolates were categorized into nine groups that one isolate of each group selected for the molecular analysis (Fig. 3). Search for similar sequences in the GenBank DNA database using Blast program (http://blast.ncbi.nlm.nih.gov/blast.cgi) showed 99–100 % similarity with valid sequences previously identified and deposited in GenBank: Candida catenulata (FSMP–Y25 GenBank FJ627977, Belloch, 2009), Candida boidinii (YM25345 GenBank KC442246, Lixia et al. 2012), Candida parapsilosis (KF214407; Taheri et al. 2013), Meyerozyma guilliermondii (HM191674; Lixia et al. 2012), Lecythophora sp. (YM24350 GenBank HQ220211, Zhou et al. 2011), Rhodotorula toruloides (GenBank AF070426, Fell et al. 1998), Trichosporon coremiiforme (CBS 8261, GenBank JN939454, Schoch et al. 2012) and Naganishia uzbekistanensis (KJ507271; Kim 2014). The determined D1/D2 domains of LSU–rDNA were deposited in the GeneBank using the NCBI database and assigned accession numbers KP324973, KP055040, KP324959, KP324968, KP324965, KP324962, KP336745 and KP324971, KP324978.

Phylogenetic analysis

An amplicon of about 600 bp was amplified for all of yeast isolates which had an almost similar size of the D1/D2 variable domain of the LSU. The D1/D2 phylogenetic trees inferred by both distance–based (data not shown) and cladistic methods showed the same topology, although there were differences in percent of bootstrapping (Fig. 4–5). Each isolate clustered in the same clade of the phylogenetic tree (with valid sequences from GeneBank with a high percentage of bootstrap support) are shown in Fig. 4–5.

 

Fig. 3. Colony of yeast species on yeast extract agar medium after three days, and morphological features. a–b. Candida boudini; c–d. Candida catenulate; e–f. Rhodotorula toruloides; g–h. Meyerozyma guilliermondii; i–j. Naganishia uzbekistanensis; k–l. Candida parasilopsis; m–n. Lecythophora sp.; o–p. Trichosporon coremiiforme. – Scale bars = 10 µm.

 

DISCUSSION

From the 25 soil samples, a total of 28 colonies of yeast fungi were isolated from different areas of Kermanshah province. The isolated yeasts belonged to six genera and eight species. Yeasts are prone to be occurred in both arable and uncultivated lands of different geographic areas from the tropics to the arctic zones. Our results show that basidiomycete yeasts are more prominent than ascomycete species in uncultivated soils. The most frequent yeast species examined are Naganishiauzbekistanensis and Trichosporoncoremiforme, which were mostly found in uncultivated soil–samples (Fig. 2). The most frequent ascomycete yeasts in uncultivated soils were Candida catenulata, C. boidinii and C. parasilopsis. Occurrence and frequency of other species did not exceed over 20%. In general, the population of yeast cells in uncultivated soil is low. Moshtaq et al. (2004) showed that occurrence of yeast in garden soil is greater than cultivated field soils which probably due to presence of different nutrients from dead and decayed plant parts. Among physiochemical factors that limit the ecology of yeasts, most important appear to be the energy sources, nutrients, temperature, pH value and water (Rose & Harrison 1987).

In Austria, Wuczkowski and Prillinger (2004) showed that the most frequent isolated genus was Cryptococcus. Members of this genus are protected against several physical and biological stresses which resist them to survive under harsh environment (Slavikova & Vadkertiova 2000, Spencer & Spencer 1997, Mokhtarnejad et al. 2015b). De Azeredo et al. (1998) showed that Cryptococcus, Cystofilobasidium, Sporobolomyces, Rhodotorula, and Trichosporon can be regularly isolated from cultivated soils. Among the ascomycete species, Candida maltosa, Debaryomyces occidentalis, Metschnikowia pulcherrima, and Williopsis saturnus are found frequently (Sláviková & Vadkertiová 2000, 2003). To date, yeasts in soils were mainly studied using culturing approaches and there are only a few reports of environmental sequences of fungi belonging to yeast lineages (Renker et al. 2004; Lynch & Thorn 2006; Buee et al. 2009). Lynch and Thorn (2006) used a cloning approach with subsequent Sanger sequencing to analyze basidiomycetes in arable soils and detected yeasts. These were already reported as soil inhabitants including; Cryptococcus podzolicus, Cr. terreus, Cr. terricola, Trichosporon dulcitum and Guehomyces pullulans. Similarly, 454– pyrosequencing of six forest soils showed a large number of sequences read of the yeasts Cr. podzolicus and Cr. terricola (Buee et al. 2009).

Wuczkowski & Prillinger (2004) and Botha (2006) reported that Cryptococcus species and some other of basidiomycetous yeasts including; Cystofilobasidium capitatum, Debaryomyces occidentalis, Lipomyces starkeyi, Metschnikowia pulcherrima, Rhodotorula glutinis, Sporobolomyces roseus, Guehomyces pullulans and Williopsis saturnus are the most frequent species of yeasts occurring in soils (Sláviková & Vadkertiová 2003; Wuczkowski & Prillinger 2004; Botha, 2006). In Iran, Mokhtarzadeh et al. (2015) obtained 25 species belonges to six genera of cultivated soils that Cryptococcus had high frequently among the isolated yeast (Mokhtarzadeh et al. 2015). The soil analysis showed that soils were basic and non–saline. Yeasts are happier to grow in a slightly acidic medium with an optimum pH between 4.5 and 5.5. Our results show that ascomycete yeasts are negatively correlated with the first CCA axis that agrees with other authors’ results. Basidiomycetous yeasts such as Naganishiauzbekestanensis, TrichosporoncoremiformiiandRodosporidium were able to grow at pH values 7–8. In our results, basidiomycete yeasts are especially alkali–tolerant that agree with Aono (1990) results. Macpherson et al. (2005) mentioned that the maintenance of a proton gradient across the plasma membrane against a constant intracellular pH of about 6.5 is vital for a yeast cell for optimal activity of critical metabolic processes (Macpherson et al. 2005). In our study, the patterns of ascomycete yeasts abundance are influenced negatively by pH that agree with former studies (Taylor & Francis 2008).

The CCA analysis has been used to display the inter–relationships between the environment and yeasts distribution. Elevation, EC and soil texture were variables measured in this study to produce longer arrows which strongly affect yeast distribution. In fact, the pattern of basidiomycete yeasts abundance was positively influenced by changes in elevation, EC, pH and clay and negatively by sand (Fig. 1).

 

Fig. 4. Maximum parsimony tree generated in Mega 4 from the alignment of 53 combined large subunit (LSU) rDNA gene (D1/D2 region) of ascomycete yeasts with 500–replication bootstrapping. The red triangles refer to ascomycete yeasts in Iran.

Fig. 5. Maximum parsimony tree generated in Mega 4 from the alignment of ten combined large subunit (LSU) rDNA gene (D1/D2 region) of basidiomycete yeasts with 500–replication bootstrapping. The red triangles refer to basidiomycete yeasts in Iran.

 

The distribution pattern of the basidiomycete yeasts seems to have a correlation with elevation, EC, pH and clay which affect their frequency. Kurtzman and Fell (1998) mentioned that correct identification of yeast species in the ecosystem is a major factor that determines the validity of studies in yeast ecology previously yeast identifications were usually based on phenotypic tests. Although, phenotype can sometimes be used to correctly identify different species, molecular comparisons have shown that those earlier identifications based on phenotype have been incorrect. Wang et al. (2015a–b) revised Pucciniomycotina and Ustilaginomycotina yeasts based on multigene sequence analyses. In this study, the yeast isolates were initially sorted based on morphology and identifications confirmed through the large subunit (LSU) rDNA gene (D1/D2 region). Based on the closest match of BLAST analysis, eight species such as Rhodotorula toruloides, Trichosporon coremiiforme, Naganishia uzbekistanensis, Candida catenulata, C. paracilopsis, C. boidinii, Lecythophora sp. and Meyerozyma guilliermondii were recovered.

This study was the first report regarding Rhodotorula toruloides, Trichosporon coremiiforme, Candida catenulata, C. boidinii and Lecythophora sp. on uncultivated soil of Iran. The phylogenetic trees generated using the neighbor joining and maximum parsimony methods, show that isolates from the same species are grouped in the same clade (Fig. 3 and 4). The sequencing of the D1/D2 of the large–subunit LSU rDNA is now widely accepted as a standard procedure for yeast identification (Hong et al. 2001; Scorzetti et al., 2002, Frutos et al. 2004). It was also found that the molecular methods based on the sequences of D1/D2 domain of the LSU–rDNA is rapid and precise, compared with the physiological methods for identification and typing of the yeastsspecies (Kurtzman and Robnett 1998, Phaff et al. 1999).

 

ACKNOWLEDGEMENTS

We wish to thank three reviewers for their constructive comments. This study was supported by the University of Razi, Iran.

 


 

 

 

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W. 1997. Gapped BLAST and PSI–BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–402.
Aono R. 1990. Taxonomic distribution of alkali–tolerant yeasts. Systematic of Applied Microbiology 13: 394–397.
Barnett JA, Payne RW, Yarrow D. 1990. Yeasts: characteristics and identification. 2nd edn. Cambridge University Press, UK.
Barnett JA, Payne RW, Yarrow D. 2000. Yeasts: characteristics and identification, 3rd edn. Cambridge University Press, UK.
Baublis JA, Wharton RA, Volz PA. 1991. Biodiversity of micro–fungi in an Antarctic dry valley. Journal of Basic Microbiology 31: 1–12.
Belloch C, Querol A, Garcia MD, Barrio E. 2000. Phylogeny of the genus Kluyveromyces inferred from the mitochondrial cytochrome–c oxidase II gene. International Journal of Systematic and Evolutionary Microbiology 50: 405–416.
Bohme H, Ziegler H. 1965. Verbreitung und keratinophilie von anixiopsis stercoraria (hansen) Hansen. Archiv fur klinische und experimentelle Dermatologie 223: 422–428.
Botha A. 2006. Yeasts in soil. In: Biodiversity and Ecophysiology of Yeasts, The yeast handbook. (Rosa C. & Peter G. eds): 221–240. Heidelberg, Springer, Germany.
Buee M, Reich M, Murat C, Morin E, Nilsson RH, Uroz S, Martin F. 2009. 454 Pyrosequencing analyses of forest soils reveal unexpectedly high fungal diversity. New Phytologist 184: 449–456.
Connell LB, Redman R, Craig SD, Rodriguez R. 2006. Distribution and abundance of fungi in the soils of Taylor Valley, Antarctica. Soil Biology and Biochemistry 38: 3083–3094.
De Azeredo LAI, Gomes EAT, Mendonca–Hagler LC, Hagler AN. 1998. Yeast communities associated with sugarcane in Campos, Rio de Janeiro, Brazil. International Microbiology 1: 205–208.
Deák T, Beuchat LR. 1996. Handbook of food spoilage yeasts. CRC Press, Boca Raton, USA.
de Barros Lopes MA, Soden A, Henschke PA, Langridge P. 1996. PCR differentiation of commercial yeast strains using intron splice site primers. Appllied and Environmental Microbiology, 62: 4514–4520.
Dmitriev VV, Gilichinskii DA, Faizutdinoova RN, Shershunov IN, Golubev VI, Duda VI. 1997. Detection of viable yeast in 3–million–year–old permafrost soils of Siberia. Microbiology 66: 546–550.
Fell JW, Boekhout T, Fonseca A, Scorzetti G, Statzell–Talman A. 2000. Biodiversity and systematics of basidiomycetous yeasts as determined by large–subunit rDNA D1 ⁄ D2 domain sequence analysis. International Journal of Systematic Evolution and Microbiology 50: 1351–1371.
Fell JW, Blatt GM, Statzell–Tallman A. 1998. Validation of the basidiomycetous yeast, Sporidiobolus microspores sp. nov., based on phenotypic and molecular analyses. Antonie Van Leeuwenhoek 74: 265–270.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–91.
Fleet GH. 1998. Yeasts – what reactions and interactions really occur in natural habitats. Food Technology and Biotechnology 36: 285–289.
Frutos RL, Fernandez–Espinar MT, Querol A. 2004. Identification of species of the genus Candida by analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers. Antonie Van Leeuwenhoek 85: 175–185.
Gadanho M, Libkind D, Sampaio JP. 2006. Yeast diversity in the extreme acidic environments of the Iberian pyrite belt. Microbial Ecology 52: 552–563.
Gee GW, Bauder JW. 1986. Particle size analysis. In: Methods of soil analysis. (PA Klute, ed): 383–411. American Society Agronomy, USA.
Ghaffari J,  Taheri Sarvtin M,  Taghi Hedayati M, Hajheydari Z, Yazdani J, Shokohi T. 2015. Evaluation of Candida Colonization and Specific Humoral Responses against Candida albicans in Patients with Atopic Dermatitis. BioMed Research International 2015: 1-5.
Guillamon JM, Barrio E, Querol A. 1996. Characterization of wine yeast strains of the Saccharomyces genus on the basis of molecular markers. Relationships between genetic distance and geographic origin. Systematic of Applied Microbiology 9: 122–132.
Guillamon JM, Sanchez I, Huerta T. 1997. Rapid characterization of wild and collection strains of the genus Zygosaccharomyces according to mitochondrial DNA patterns. Federation of European Microbiological Societies Microbiology Letters 147: 267–272.
Guillamón JM, Sabaté J, Barrio E, Cano J, Querol, A. 1998. Rapid identification of wine yeast species based on RFLP analysis of the ribosomal internal transcribed spacer (ITS) region. Archives Microbiology 169: 387–392.
Hall TA. 1999. BioEdit: a user–friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Axford: Nucleic acids symposium series; P. 95–8.
Hagler AN, Ahearn DG. 1987. Ecology of aquatic yeasts. In: The yeasts, 2nd edn. (AH Rose & JS Harrison, eds): 181–205. Academic Press, London, UK.
Hierro N, Gonzalez A, Mas A, Guillamon JM. 2004. New PCR–based methods for yeast identification. Journal of Applied Microbiology 97: 792–801.
Hong SG, Chun J, Bae KS. 2001. Metschnikowia koreensis sp. nov., a novel yeast species isolated from flowers in Korea. International Journal of Systematic Evolution and Microbiology 51: 1927–1931.
Jensen V. 1963. Studies on the microflora of Danish beech forest soils II. Numbers of microorganisms as determined by plate counts. Zbl. Bakt. Parazitenk II Abt. 116: 348–371.
Kachuei R, Emami M. Naeimi B, Diba K. 2012. “Isolation of keratinophilic fungi fromsoil in Isfahan province, Iran,” Journal de Mycologie Medicale 22: 8–13.
Kumar S, Tamura K, Nei M. 2004. MEGA 3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinformatic 5: 150–163.
Kurtzman CP, Fell JW. 1998. The yeasts, a taxonomic study. 4th edn. Elsevier, Amsterdam, the Netherlands.
Kurtzman CP, Robnett CJ. 1997. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large–subunit (26S) ribosomal DNA gene. Journal of Clinical Microbiology 35: 1216–1223.
Kurtzman CP, Fell JW. 1998. Definition, classification and nomenclature of the yeasts. In: The yeasts, a taxonomic study, 4th edn. (CP Kurtzman & JW Fell eds): 3–5. Elsevier, Amsterdam, the Netherlands.
Kurtzman CP, Fell JW.1999. The yeasts, a taxonomic study. Elsevier, Amsterdam, the Netherlands.
Kurtzman CP, Fell JW. 2006. Yeast systematics and phylogeny implications of molecular identification methods for studies in ecology. In: Biodiversity and ecophysiology of yeasts. (G Peter & C Rosa, eds): 11–30. SpringereVerlag, Berlin, Germany.
Lixia Z, Mingfu G, Dongqi G, Christensen M, Xujie H, Hongmei L, Yingge F, Shu F. 2012. Preliminary analysis of yeast communities associated with the spontaneous fermentation of Musalais, a traditional alcoholic beverage of Southern Xinjiang, China. South African Journal of Enology and Viticulture 33(1):133–143.
Lynch MDJ, Thorn RG. 2006. Diversity of basidiomycetes in Michigan agricultural soil. Applied and Environmental Microbiology 72: 7050–7056.
Macpherson N, Shabala L, Rooney H, Jarman MG, Davies JM. 2005. Plasma membrane H+ and K+ transporters are involved in the weak–acid preservative response of disparate food spoilage yeasts. Microbiology 151: 1995–2003.
Mokhtari M, Etebarian HR, Mirhendi SH, Razavi M. 2011. Identification and phylogeny of some species of the genera Sporidiobolus and Rhodotorula using analysis of the 5.8s rDNA gene and two ribosomal internal transcribed spacers. Archives of Biolology Science Belgrade 63: 79–88.
Mokhtarnejad L, Arzanlou M, Babai–Ahari A, Turchetti B. 2015a. Molecular identification of basidiomycetous yeasts from soils in Iran. Rostaniha 16: 61–80.
Mokhtarnejad L, Arzanlou M, Babai–Ahari A. 2015b. Molecular and phenotypic characterization of ascomycetous yeasts in hypersaline soils of Urmia Lake basin (NW Iran). Rostaniha 16: 174–185.
Mokhtarnejad L, Arzanlou M, Babai–Ahari A, Di Mauro S, Onofri A, Buzzini P, Turchetti B. 2016. Characterization of basidiomycetous yeasts in hypersaline soils of the Urmia Lake National Park, Iran. Extremophiles 20: 915–928.
Mok WI, Luizao RCC, Do Socorro BDS, Teixeira MFS, Munitz EG. 1984. Ecology of pathogenic yeasts in Amazonian soil. Applied and Environmental Microbiology 47: 390–394.
Mushtaq M, Sharfun–Nahar Hashmi MH. 2004. Isolation and identification of yeast flora from soil of Karachi, Pakistan. Pakistan Journal of Botany 36: 173–180.
Nagahama T, Hamamoto M, Nakase T, Takami H,  Horikosi K. 2001. Distribution and identification of red yeasts in deep–sea environments around the northwest Pacific Ocean. Antonie Van Leeuwenhoek 80: 101–110.
O’Donnell k. 1993. Fusarium and its near relatives. In: The fungal holomorph: mitotic and pleomorphic speciation in fungal systematics. DR Reynolds & JW Taylor eds): 225–233. CAB International, Wallingford, UK.
Phaff HJ, Starmer W. 1987. Yeasts associated with plants, insects and soil. In: The yeasts, vol. 1, Biology of yeasts (AH Rose & JS Harrison, eds): 123–180. Academic Press, London, UK.
Phaff HJ, Starmer WT, Kurtzman CP. 1999. Pichia lachancei sp. nov. associated with several Hawaiian plant species. International Journal of Systematic Bacteriology 49: 1295–1299.
Renker C, Blanke V, Borstler B, Heinrichs J, Buscot F. 2004. Diversity of Cryptococcus and Dioszegia yeasts (Basidiomycota) inhabiting arbuscular mycorrhizal roots or spores. FEMS Yeast Research 4: 597–603.
Rhoades JD. 1996. Salinity: Electrical conductivity and total dissolved solids, P: 417–435. In: Methods of soil analysis. (DL Sparks, ed). Part 3. Chemical methods. Soil Science Society of America, Madison, Wisconsin, USA.
Rose AH, Harrison JS. 1987. The yeasts: Vol. 1–5. Academic Press, London, UK.
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National of Sciences of the United States of America 109: 6241–6246.
Scorzetti G, Fell JW, Fonseca A, Statzell–Tallman A. 2002. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Research 2: 495–517.
Slavikova E, Vadkertiova R. 2000. The occurrence of yeasts in the forest soils. Journal of Basic Microbiology 40: 207–212.
Slavikova E, Vadkertiova R. 2003. The diversity of yeasts in the agricultural soils. Journal of Basic Microbiology 43: 403–436.
Spencer JFT, Spencer DM. 1997. Yeasts in natural and artificial habitats. Springer, Berlin, Germany.
Suh SO, Zhang N, Nguyen N, Gross S, Blackwell M. 2008. Lab manual for yeast study. Mycology lab Louisiana State University, USA.
Thomas GW. 1996. Soil pH and Soil acidity, PP: 475–495. In: Methods of soil analysis. Chemical methods, Part 3. (DL Sparks ed). Soil Science Society of America, Madison, Wisconsin, USA.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG.1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876–82.
Török T, Royer C, Rockhold D, King AD.1992. Electrophoretic karyotyping of yeasts, and Southern blotting using whole chromosomes as templates for the probe preparation. Journal of Genetic and Applied Microbiology 38: 313–325.
Török T, Rockhold D, King AD. 1993. Use of electrophoretic karyotyping and DNA–DNA hybridization in yeast identification. International Journal of Food Microbiollogy 9: 63–80.
Tosi S, Casado B, Gerdol R, Caretta G. 2002. Fungi isolated from Antarctic mosses. Polar Biology 25: 262–268.
Vaughan–Martini A, Martini A. 1987. Three newly delimited species of Saccharomyces sensu stricto. Antonie van Leeuwenhoek 53: 77–84.
Versavaud A, Hallet JN. 1995. Pulsed–field gel electrophoresis combined with rare–cutting endonucleases for strain identification of Candida famata, Kloeckera apiculata and Schizosaccharomyces pombe with chromosome number and size estimation of the two former. Systematic and Applied Microbiology 18: 303–309.
Vezinhet F, Blondin B, Hallet J. 1990. Chromosomal DNA patterns and mitochondrial DNA polymerphism as tools for identification of enological strains of Saccharomyces cerevisiae. Appllied of Microbiology and Biotechnology 32: 568–571.
Vishniac HS. 1996. Biodiversity of yeasts and filamentous microfungi in terrestrial Antarctic ecosystems. Biodiversity Conservative 5: 1365–1378.
Waksman SA, Fred EB. 1922. A tentative outline of the plate method for determining the number of microorganisms in the soil. Soil Science 14: 27–28.
Wang QM, Yurkov AM, Göker M, Lumbsch HT, Leavitt SD, M. Groenewald M, Theelen B, Liu XZ. Boekhout T, Bai FY. 2015a. Phylogenetic classification of yeasts and related taxa within Pucciniomycotina. Studies in Mycology 81: 149–189.
Wang QM, Begerow D, Groenewald M, et al. 2015b. Multigene phylogeny and taxonomic revision of yeasts and related fungi in the Ustilaginomycotina. Studies in Mycology 81: 54–80.
Wuczkowski M, Prillinger H. 2004. Molecular identification of yeasts from soils of the alluvial forest national park along the river Danube downstream of Vienna, Austria (“Nationalpark Donauauen”). Microbiological Research 159: 263–275.
Yamamoto N, Yamamoto N, Amemiya H, Yakomori Y, Shimizu K, Totsuka A. 1991 Electrophoretic karyotypes of wine yeasts. American Journal of Enology and Viticulture 4: 358–363.
Zhou X, Li Z, Yang L, Dong M, Li S. 2011. Identification of yeasts isolated from Chenghai Lake, a plateau lake in Yunnan province. Wei Sheng Wu Xue Bao 51(4):547-53.