Expression analyses of endoglucanase gene in Penicillium oxalicum and Trichoderma viride

Document Type : Original Article

Authors
1 Department of Plant Protection, Faculty of Agriculture, University of Zabol, Zabol, Iran
2 Department of Plant Protection, and Institute of Plant Biotechnology (Biocenter), University of Zabol, Zabol, Iran.
3 Department of Plant Protection, Sari Agricultural Science and Natural Resources University, Sari, Iran.
Abstract
The expression of endoglucanase gene and protein profile belonging to two fungal species, Penicillium oxalicum 1SMS and Trichoderma viride 156MS with high cellulase enzyme activity, was investigated. Fungal isolates were cultured on inducer CMC medium and then the amount of released sugar and protein were assayed every three days for a month, using arsenate molybdatereagent and Bradford method, respectively. Detection of endoglucanase gene was performed by using specific primers. Expressed cDNA fragments in two isolates revealed a size of 1380 bp to 1434 bp length. The cDNAs were sequenced and queried in BLASTN and TBLASTX search against eg1 genes from other fungi. These sequences showed 98% homology to eg1 gene deposited in databases. SDS-PAGE pattern of protein separation revealed one protein band for each isolate having a molecular weight of 49.786 and 48.339 kDa with 487 and 460 amino acids. Bioinformatics analysis revealed glycosyl hydrolase domains, a cellulase banding domain and 6 PROSITEs for both proteins. One ORF in each gene region was determined for each species. The results indicated that carboxy methyl cellulose is able to induce expression of eg1, following endogluconase enzyme production.
Keywords
Subjects

INTRODUCTION

Cellulose is a water insoluble polysaccharide and the most abundant degradable hydrocarbons in nature, which is composed of D-glucopyranosyl units joined by 1,4-glycosidic bonds. Cellulose plays an important role in changing stabilized carbon to CO2, as well as producing sustainable biological and bio-energy products to replace fossil fuels (Chojoghi et al. 2005). Biological degradation of cellulose in soil could be performed by cellulase enzyme produced endogen-
ously by many microorganisms such as fungi, bacteria and Protista (Li et al. 2009). A number of enzymes with cellulose activity classified in family 9 from various organisms from which cellulases have been reported (Arai et al. 2003).

Cellulolytic enzymes should be either secreted in the environment or connected to outer surface ofcellulolytic microorganisms. These enzymes usually act together synergistically. They are able to hydrolyze β-1, 4 glycosidic bands in cellulose and change it to CO2 and H2O (in aerobic condition), and CO2, H2O, and CH4 (in anaerobic condition). These enzymes are; 1-4-β-D- glucanase or endoglucanases (EG, EC 3.2.1.4), which hydrolyze internal glycosidic bands and 1-4-β-D-glucancellobiosehyrolase or exoglucanase (CBH, EC 3.2.1.9.1), which releases cellobiose units from the fungi can grow on cellulose as the sole source of carbon. Cellulase enzyme is one of the most important ends of the cellulose chain; 1-4-β-D-glucosidases (βGLC, 3.2.1.21) which separates glucose units from linear cellulose (cello-oligosaccharides) (Coughlan, 1990). Some microorganisms such as fungi are able to degrade cellulose. Fungi play an important role in degrading the cellulosic compounds due to their strong enzymatic systems (Jorgensen & Olsson 2006).

Detection and manipulation of some fungal species as cellulose producers has been interested many research centers, because of their application in starch processing, grain alcohol fermentation, extraction of fruit juices, pulp and paper industry and textile industry (Gao et al. 2008). Among hundreds of fungal species which are capable of developing on materials containing cellulose as the source of carbon, some of them could produce cellulose enzyme to degrade cellulose (Suurnakki et al. 2000). Previously, we have reported that some fungal species of different genera (Fusarium solani,Trichoderma viride,
T. reesei
, T. koningii and Aspergillus terreus) can produce cellulolytic enzymes with high activity rate (Leylai et al. 2011a). Saprophytic fungi could be regarded as one of the most beneficial sources of cellulolytic enzymes. More than one hundred industrial enzymes have been introduced in agricultural, food and paper industries (Bhat 2000).

Withregard to the important role of these enzymes in industry, in this study, we attempted to determine the profile of endogluconase gene expression and its related proteins in two selected isolates of fungi with high cellulase activity.

 

MATERIALS AND METHODS

 

Fungal culture and media

Sampling was performed from soil of agricultural areas in north of Iran during 2009-2010. Soil suspension was prepared and cultured on water-agar medium. After growing fungi for five days, a six-mm disc of fungal colony was transferred to Potato Dextrose Agar (PDA, Merk, Germany) medium. A total of 300 isolates were used for celluase activity assay. Cellulose degradation in vitro was evaluated by providing minimal medium containing nitrogen sources, micro-elements, and carboxymethyl cellulose as the only carbon source (Leylai et al. 2011b). Induction of isolates was performed by carboxymethyl cellulose (CMC) to release cellulase in culture medium inside 100-ml conical flask containing fresh hypha of fungi. Experiments were done at 25 ºC in three independent replications.

 

Sugar and protein assay

Sugar assay was done four days after induction and continued for one month. Released glucose in culture media was detected by using ammonium molybdate reagent. Absorption was read by spectrophotometer at 575 nm wave length (Kossem & Nannipieri 1995). Endoglucanase activity was determined in a duplicate reaction mixture containing 200 μl 1% CMC-Na (w/v, dissolved in 100 mM sodium acetate buffer, pH 6) and 100 mM NaCl. The reactions were allowed to proceed for 10 min at 50 °C and terminated by adding 0.5 ml dinitrosalicylic acid (DNS) and then heating in a boiling water bath for 10 min. The absorbance was measured at 540 nm, using Novospect II spectrophotometer (Pharmacia). One unit of enzyme is defined as the amount of enzyme that catalyzes the formation of 1 μmol glucose/min under defined assay conditions (Li et al. 2009). Protein purification procedures were carried out at 4°C with chromatographic monitored at 280 nm wave length. Protein concentrations were determined by the method of Bradford (Bradford 1976), using serum albumin as standard treatment. SDS–PAGE was performed in 10% SDS–PAGE and proteins were visualized by silver staining (Morrissey 1981). A band of about 66 kDa was cut out and kept in CMC medium for 24 h at 25°C. Protein extraction and purification from gel was performed using AllPrep Mini kit (Qiagen) according to manufacturer’s protocol. The sequence of N-terminal amino acid of the intact enzyme was determined by using an automated sequencer (Applied Biosystem, ABI, USA).

 

RNA isolation and reverse transcription

Total RNAs from induced hypha in culture medium was performed using a standard phenol-chloroform procedure and purified using RNA purification Kit (Qiagene). Total RNA was quantified using a Scandrop spectrophotometer (Analytika, Germany) and RNA quality was assessed by 1% agarose gel electrophoresis stained by Ethidium bromide. The integrity of RNA was evaluated with an Agilent 2100 bioanalyzer (Agilent Technologies). First-strand cDNA was synthesized from total RNA using Roch extraction solution (Roch, Germany). 50-100 ng of the total RNA from each CMC stimulated cell was used to prepare double-strand cDNA using Ominiscrip kit (Qiagene, Germany) according to manufacturer’s protocol.

 

Primer design and polymerase chain reaction

Primers used in this study were designed by using NTI software and Primer 3 site (http://frodo.wi.mit.
edu). The primers were checked for secondary structures with oligoanalyser software (http://www.
idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx
). The primers used in this study are summarized in Table 1.

 

 

Table 1. The primers used in this study.

Primer name*

Tm

5'-3' sequence

Length

Tm

PO1

60

ATGTCTTTCACAAGGAGACAG

21

60

PO11

60

TCACAGGCACTGAGAGTAGTAG

22

60

TV1

65

TTGTCCCAATATGGCGCCCTC

21

65

TV11

66

GCAATGCCTTTAGAGCGTTGAC

22

66

*PO: Penicillium oxalicum 1SMS and TV: Trichoderma viride 156M

 

 

 

 

 

 

 

 

PCR assay

To identify β-1,4-endoclocanase sequence, the PCR assay was performed by using related specific primers (Table 1). The reaction mixtures were prepared in a total volume of 25 μl with a final concentration of 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 0.2 mM of each dNTP and 1.5 mM MgCl2. For each reaction, 1.5 U of Taq DNA polymerase (Fermentas, France), 15 pmol of each primer and 25 ng of fungal template DNA were added. The PCR reaction was performed in a thermocycler (Eppendorf Mastercycler Gradient, Hamburg, Germany) using the following program: an initial denaturation step at 94° for 2 min, 40 cycles of 94 °C (30 s), 60 °C - 66 °C (30 s), 72 °C (60 s), and a final extension step at 72 °C for 10 min. A negative control, deleting DNA template, was used in every set of reactions. PCR products were separated by electrophoresis on 1.5% agarose gels stained with Ethidium bromide (0.5 µg/ml) in 40 mM Tris–acetate and 1.0 mM EDTA and then photographed under UV light. Extraction of purified PCR fragment was done using a Silica Bead DNA Gel Extraction kit (Fermentase, USA), according to the manufacturer’s protocol.

 

DNA Sequencing

The 5’-end DNA sequencing was conducted with an ABI 3700 sequencer at Macrogen Company in South Korea. The cDNA sequences were screened for quality and then queried using the National Center for Biotechnology Information (NCBI) standalone BlastAll program against the BLASTN (nucleic acid), TBLASTX (translated protein query search), Swissprot, version 6.0 UniProt and UniRef100. PROSITEs were specified using NPSA server (http://npsapbil.ibcp.fr/cgibin/npsa_automat.pl?page=/NPSA/npsa_server.html). Sequence similarities above 98% and E values less than 1E-10 were considered as statistically significant positive matches (data not presented). Sequences that matched to hypothetical proteins or had low similarity to a known protein were considered as unknown genes.

 

RESULTS

 

Sugar and protein assay

Sugar and protein released in inducer medium were measured at different time intervals. There was fluctuation in the amount of released glucose during sugar measurement in studied isolates.

 Presence of glucose in fungal culture medium showed cellulose decomposition. According to these results, variation in amount of glucose are significantly observed during the measurement which is due to fungal activity to provide required conditions for growing and producing the maximum amount of enzyme. Regarding the amount of the released sugar and protein, isolates were graded; two isolates with high activity were selected for future experiments (Table 2). The maximum amount of the enzyme was obtained 13 days after inoculation for different isolates in culture media. Results showed that the amount of enzyme was decreased. This might be due to either aging of fungi and presence of secondary metabolites or reduction of materials in culture media. The resulted data indicated that two isolates, Penicillium oxalicum 1SMS and Trichoderma viride 156MS possessed the maximum enzyme production rates which were 0.078 mg/L and 0.075 mg/L, respectively.

Endoglucanase enzyme evaluation showed that the two isolates could produce 0.06578 and 0.05989 mg/L protein, respectively. SDS-PAGE analysis also indicated a protein with molecular weight of 45-66.2 kDa, which is able to release glucose according to enzyme verification test (Fig 1).

 

 

 

Table 2. Bioinformatics analysis of N-glycosylation site related to endoglucanase gene in two studied fungal species

 

N-glycosylation site in Penicillium  oxalicum access number: PS00001

N-glycosylation site in Trichoderma viride access number: PS00001

Randomized probability: 5.138e-03

Site: 97 to 100 NYTS. Identity

Site: 202 to 205 NGTL. Identity

 

Randomized probability: 5.138e-03
Site: 78 to 81 NTTL. Identity
Site: 164 to 167 NGSL. Identity
Site: 204 to 207 NGTL. Identity
Site: 208 to 211 NTSH. Identity
Site: 394 to 397 NSTA. Identity

 

Fig. 1. SDS–PAGE analysis of purified enzyme stained with coomassie R-250 brilliant blue. (A): protein profile produced by Trichoderma viride (lan 1) and (B):.Peninicilium oxalicum at inducer CMC medium (lane 2). M: protein size marker.

 


Trichoderma viride 156MS

Amplified product of endogluconase gene in Trichoderma viride 156MS isolates, which was provided by using specific primer, showed a yielded fragment ranging from 1400 to 1600 bp (Fig 2A). This sequence showed 98% similarity with the same gene in Trichoderma isolates having a fragment of 1700 bp in database. The sequence of T. viride156MS which was characterized in this part has been recorded in GenBank under accession number of JN247430. Bioinformatic analyses of queried sequence showed an open reading frame (Fig 2B).

 

Penicillium oxalicum 1SMS

Amplified fragments produced in PCR reaction by usingspecific primer showed a ranging in size from 1400 to 1700 bp on electrophoresisgel (Fig 3A). Nucleotide sequence related to coding region of eg1 in Penicillium oxalicum cited in NCBI database, has the size of 1437 bp. Comparison of amplified sequences with those of 5-P flanking regions of cellulase genes in other fungi revealed the large areas of homology about 98%. The sequence related to coding region of β-1,4 endoglucanase (CDs) showed a high degree of nucleotide sequence similarity to genes assigned in the genomes of Penicillium isolates. Protein sequence also showed a strong sequence similarity to endoglucanase genes in Penicillium isolates. The sequence determinationof this isolate has been deposited in GenBank under accession number of JF309107. Bioinformatics analysis of queried sequence showed an open reading frame (Fig 3B).

 

 

 

 


 

 

Fig. 2. (A) Related fragments of endoglucanase gene (Line 3) and cDNA of expressed eg1 gene (Lines 1-2) amplified by using specific primers for Trichoderma viride 156MS. (B) ORF of coding sequence region (cDNA) related to Endoglucanase gene in T. viride 156MS.

 

 


 

 

Fig. 3. (A) Related fragments of endoglucanase gene (Line 1) and cDNA of expressed eg1 gene (Lines 2-3) amplified

 

by using specific primers for Penicillium oxalicum 1SMS.(B) ORF of coding sequence region related to

 

endoglucanase gene in P. oxalicum 1SMS.

 

 

Bioinformatics assays

Two queried sequences were analyzed in CDD (Conserve Domain Database) at NCBI. Results from bioinformatics analysis indicated that our queried sequence has two glycosylhydrolase and Cellulase Binding Domain (CBD). As with CBDs, catalytic domains have been delineated in some cellulases by proteolysis (Ghangas & Wison 1988, Mo & Hayashida 1988, Tomme et al. 1988, Gilkes et al. 1989). These results revealed that duplicated sequences are related to endoglucanase I gene, which change crystalline cellulose to linear chains. Prosites analysis revealed that the specified proteins have six prosites which are quite similar to that of all six prosite active sites. This domain has glycosation sites which hydrolyze glycosidic band between two or more carbohydrates or between carbohydrate and non-carbohydrate (Table 2). Their difference is in passive sites. Molecular weight of the two proteins was evaluated using ClC bio software. Molecular weight was determined as 49.786 kDa (IEPs = 5/21) for P. oxalicum 1SMS, and 48.339 kDa (IEPs = 5.45) for T. viride 156MS.

 

DISCUSSION

 

The ability of different fungi such as Trichoderma and Aspergillus to produce cellulolytic enzymes on different sources of carbon in submerged culture has already been investigated (Ilm`en et al. 1997; Morikawa et al. 1995). These enzymes consist endo-L-1,4-glucanases (EGs), cellobiohydrolases (CBHs) and L-glucosidases (BGLs). In this research, cellulase activity of two soil fungi was investigated. CMC was used as enzyme production inducer in culture medium. Biomass growth of induced fungi and presence of free sugar in culture medium showed the ability of studied fungal isolates to produce cellulose enzyme. Macris (1983) surveyed some genera like Trichoderma, Fusarium, Aspergillus, Phanerocheate, Chrysosporium and Sclerotium showed some differences in their cellulase activity. A study about surveys on cellulase activity of different genera reported that T. harzianum and A. niger showed highest and Trichothecium roseum, Trichoderma reesei, A. ochraceus and Penicillium italicum exhibited lower activity against CMC (Sazci et al. 1986). Measurement of cellulase activity among 115 isolates of fungi showed that Trichoderma, Aspergillus and Fusariums trains had the highest activity (Jahangeer et al. 2005). In this study, biochemical analysis of sugar and protein assays showed different ranges of enzyme production in tested isolates. Screening of isolates’ enzyme activity determined two isolates with high activity. Study of structure and expression properties of the endo-L-1,4-glucanase, a gene from the filamentous fungus
A. nidulans, revealed that eglA promoter nucleotide sequence has no major areas of homology with 5 P-flanking regions of other fungal cellulose genes (Chikamatsu et al., 1999). The analysis of related sequences of studied gene showed a high sequence homology with those sequences related to enzyme production in other fungi. These results indicated the high potential of these species for industrial application. The comparison of deduced amino acid sequences showed a slight variation between isolates with high and low cellulose activity. This variation may be caused by mutation in nucleic acid sequence. This fact has been demonstrated using mutated strain in engl gene but in this study we tested our wild strains in natural condition. DNA sequencing has allowed rapid determination of amino acid sequences of cellulases. Sequences analysis and comparison with similar sequences in database revealed that the conserved stretches are common to both cellulases and xylanases. The conserved sequences occur in discrete domains connected by linkers which allow the domains to function independently. Some studies have demonstrated strong correlations between
N-glycosylation and cellulose activities (Knowles et al. 1987, Stals et al. 2004, Wei et al. 2005). Glycosylation has also an important role in stability and activity of endogluconase. DNA sequencing of eng1 in studied species revealed different Prosite of N-glycosylation with known endoglucanase genes. Our results indicated that formation of endoglucanase enzymes is inducible in both P. oxalicum and T. viride. This is in congruence with several other fungi that have been grown on different media as carbon sources (Ilm`en et al. 1997, Morikawa et al. 1995). This finding also confirms the high level of enzyme activity of studied species. At this time, the mechanism of cellulase induction is obscure and non-explicit knowledge is available. So, further molecular studies such as DNA manipulation and signaling pathways involved in regulatory mechanisms will be necessary for clarification. These results highlight the industrial potentials of studied isolates as possible raw materials for cellulase enzyme production and landscape of application of these enzymes to produce chemical fuels. These results illustrate the industrial potentials of studied species as possible microorganism for cellulase enzyme production

 

Arai T, Araki R, Tanaka A, Karita S, Kimura T, Sakka K, Ohmiya K. 2003. Characterization of a cellulase containing a family 30 carbohydrate - binding module (CBM) derived from Clostridium thermocellum CelJ: importance of the CBM to cellulose hydrolysis. Journal of Bacteriology 185: 504-512.
Bhat M. 2000. Cellulases and related enzymes in biotechnology. Biotechnology Advances 18: 355-383.
Bradford MM. 1976. A rapid and sensitive method for quantification of microgram quantities of protein of utilizing the principle dye binding analaysis. Biochemistry 72: 248-252.
Chikamatsu G, Shirai K, Kato M, Kobayashi T, Tsukagoshi N. 1999. Structure and expression properties of the endo-β-1, 4-glucanase A gene from the filamentous fungus Aspergillus nidulans. FEMS Microbiology Letters 175: 239-245.
Chojoghi F, Motallebi M, Zamany MR. 2005. The study of cellobiohydrolase production from Trichoderma reesei. Iranian Jornal of Biology 84: 15-23.
Coughlan MP. 1990. Cellulose degradation by fungi. In: Microbial enzyme and biotechnology. (WM Fogarty, CT Kelly, eds): 1-368. Elsevire Science, London, UK.
Gao J, Weng H, Zhu D, Yuan M, Guan F. 2008. Production and characterization of cellulolytic enzymes from the thermoacidophilic fungal Aspergillus terreus M11 under solid state cultivation of corn stover. Bioresours Technology 99: 7623-7629.
Ghangas GS, Wilson DB 1988. Cloning of the Thermomonospora fusca endoglucanase E2 gene in Streptomyces lividans: affinity purification and functional domains of the cloned gene product. Applied Environmental Microbiology 54: 2521-2526.
Gilkes NR, Kilburn DG, Miller RCJr, Warren RA. 1989. Structural and functional analysis of a bacterial cellulase by proteolysis. Journal of Biological Chemistry 264:17802-17808.
Ilm`en M, Saloheimo A, Onnela M, Penttila M. 1997. Regulation of cellulase gene expression in the filamentous fungus Trichoderma reesei. Applied Environmental Microbiology 63:1298-1306.
Jahangeer S, Khan N, Jahangeer S, Sohail M, Shahzad S, Ahmad A, Ahmed Khan S. 2005. Screening and characterization of fungal cellulases isolated from the native environmental source. Pakistan Journal of Botany 37: 739-748
Jorgensen H, Olsson L. 2006. Production of cellulases by Penicillium brasilianum IBT 20888: effect of substrate on hydrolytic performance. Enzyme and Microbial Technology 38: 381-390.
Knowles J, Lehtovaara P, Teeri T. 1987. Cellulase families and their genes. Trends in Biotechnology 5: 255-261.
Kossem A, Nannipieri P. 1995. Soil cellulose activity methods. In: Applied soil microbiology and biochemmistry. (A Kossem, P Nannipieri, eds): 345-350. Academic Prees, San Diego, USA.
Leylai S, Sabbagh SK, Tajick-Ghanbari MA, Salari M. 2011a. CMC-ase activity of some soil fungi. Annals of Biological Research 2: 453-460.
Leylai S, Sabbagh SK, Tajick-Ghanbary MA, Lotfi A, Salari M. 2011b. Protein and sugar assay, characterization and expression of endoglucanase gene in Trichoderma longibrachiatum 36MS and Aspergillus terreus 31MS. World Applied Sciences Journal 15: 904-908.
Li Y, Ding M, Zhao F. 2009. Purification, characterization and molecular cloning of a novel endo-β-1,4-glucanase AC-EG65 from the mollusc Ampullaria crossean. Comparative Biochemistry and Physiology 153: 149-156.
Macris BJ. 1983. Production and characterization of cellulose and ß–glucosidase from a mutant of Alternaria alternate. Applied Environmental Microbiology 47: 560-565.
Mo, K., Hayashida S. 1988. Conversion of Geotrichum candidum endocellulase I to endocellulase II by limited proteolysis. Agricultural and Biological Chemistry 52: 1683-1688.
Morikawa Y, Ohashi T, Mantani O, Okada H. 1995. Cellulase induction by lactose in Trichoderma reesei PC-3-7. Applied Microbiology and Biotechnology 44:106-111.
Morrissey JH. 1981. Silver stain for proteins in polyacrylamide gels: a modified procedure with enhanced uniform sensitivity. Analytical Biochemistry 117: 307.
Sazci A, Radford A, Erenle K. 1986. Detection of cellulolytic fungi by using Congo red as an indicator: a comparative study with the dinitrosalicyclic acid reagent method. Applied Bacteriology 61: 559-562.
Stals I, Sandra K, Geysens S, Contreras R, van Beeumen J, Claeyssens M. 2004. Factors influencing glycosylation of Trichoderma reesei cellulases. I: Postsecretorial changes of the O- and N-glycosylation pattern of Cel7A. Glycobiology 14: 713-724.
Suurnakki A, Tenkanen M, Siika-aho M-L, Niku-Paavola A, Viikari L., Puchert J. 2000. Trichoderma reesei cellulases and their core domains in the hydrolysis and modification of chemical pulp. Cellulose 7: 189 - 209.
Tomme P, van Tilbeurgh H, Pettersson G, van Damme J, Vandekerckhove J, Knowles J, Teeri T, Claeyssens M. 1988. Studies of the cellulolytic system of Trichoderma reesei QM 9414. Analysis of domain function in two cellobiohydrolases by limited proteolysis. European Journal of Biochemistry 170: 575-581
Wei YD, Lee SJ, Lee KS, Gui ZZ, Yoon HJ, Kim I, Je YH, Guo X, Sohn HD, Jin BR. 2005. N-glycosylation is necessary for enzymatic activity of a beetle (Apriona germari) cellulase. Biochemical and Biophysical Research Communications 329: 331-336.